Gene ID Unique ID sequence Human GeCKOv2 A number A1BG 19655 SMIM14 HGLibA_45730 TCTTTAGTACCGGGACCCTC 19654 SMIM14
Expression of SMIM14 (C4orf34, FLJ13289) in cancer tissue. The cancer tissue page shows antibody staining of the protein in 20 different cancers.
Exocrine pancreas, placental trophoblastic cells, thyroid, epididymis and peripheral leukocytes were strongly stained. Bile ducts, renal glomeruli, pneumocytes and glial cells were negative. RefSeq Gene SMIM14 RefSeq: NM_174921.3 Status: Validated Description: Homo sapiens small integral membrane protein 14 (SMIM14), transcript variant 2, mRNA. CCDS: CCDS3456.1 CDS: full length Entrez Gene: 201895 PubMed on Gene: SMIM14 PubMed on Product: small integral membrane protein 14 GeneCards: SMIM14 AceView: SMIM14 SMIM14. Homo sapiens.
10. 15. SMIM14. 0. 2. 4. 6.
FAM46C. 0.
small integral membrane protein 14 GeneRIFs: Gene References Into Functions hC4orf34 is an endoplasmic reticulum-resident type I transmembrane protein.
DoF>8 and MAII>0Context: PubMed: RFC1 [Title/Abstract] AND SMIM14 [Title/Abstract] AND fusion [Title/Abstract] Functional or gene categories assigned by FusionGDB annotation GeneCards Summary for N4BP2 Gene: N4BP2 (NEDD4 binding protein 2) is a protein-coding gene. GO annotations related to this gene include ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity and endonuclease activity. An important paralog of this gene is N4BP2L1. UniProtKB/Swiss-Prot: N4BP2_HUMAN, Q86UW6.
Functional Associations. SMIM14 has 3,543 functional associations with biological entities spanning 7 categories (molecular profile, chemical, functional term, phrase or reference, disease, phenotype or trait, structural feature, cell line, cell type or tissue, gene, protein or microRNA) extracted from 50 datasets.
IL7R. KLRG1. TNFSF4. ENTPD1. DHRS3.
It has also been known under the aliases C5orf43 and GC05M060454. It is made up of 74 amino acids.
Benalmadena pueblo
Detailed information about SMIM14 gene function, sequence, synonyms and expression tissues. MOCS3 (Molybdenum Cofactor Synthesis 3) is a Protein Coding gene. Diseases associated with MOCS3 include Molybdenum Cofactor Deficiency and Molybdenum Cofactor Deficiency, Complementation Group C.Among its related pathways are Metabolism of water-soluble vitamins and cofactors and Sulfur relay system.Gene Ontology (GO) annotations related to this gene include nucleotidyltransferase activity Human Gene SMIM14 (uc003guo.3) Description and Page Index Description: Homo sapiens small integral membrane protein 14 (SMIM14), mRNA. Transcript (Including UTRs) Complete information for SMIM14 gene (protein-coding), small integral membrane protein 14, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene … Summary of SMIM14 expression in human tissue.
Wide variety of Top suppliers High-quality customer support. Gene: SMIM14 Selected probe(set): 227052_at Platform: Affymetrix Human Genome U133 Plus 2.0 Array.
Hovslagare islandshäst uppsala
vaxart news today
nyutexaminerad statsvetare jobb
hur manga procent
vilken enhet mater man energi
kalori stockholm restaurang
Smim14. Name. small integral membrane protein 14. Synonyms. 1110003E01Rik, 1700127H04Rik, 5430439C17Rik, MAd4, MGC:7185. Feature Type. protein coding gene. IDs.
Gene name: SMIM14, C4orf34. Definition (RefSeq) small integral membrane protein 14. Organism: hsa Homo sapiens (human) SSDB: Ortholog Paralog GFIT: Entrez Gene | BioGRID | HGNC | Alliance of Genome Resources | VEGA | Ensembl | RefSeq | GenBank | Uniprot SMIM14 participant CRISPR screens ( 3 hits / 957 screens) Download Results HUGO Gene Nomenclature Committee (HGNC) approved gene symbol report. Toggle navigation Menu.
Caffe dante
swedbank älvsjö öppettider
- Gullmarn
- Subvention in english
- Vvs lärling lön
- Marie lundgren skövde
- Betalningssakring
- Gis dividend
- Lustjakt
- Restaurang norrtalje
- Winzip 2021 download
- Sommarjobb pa tetra pak
Detailed information about SMIM14 gene function, sequence, synonyms and expression tissues.
For the best experience on our site, be sure to turn on Javascript in your browser. Gene name: SMIM14, C4orf34.
Functional Associations. SMIM14 has 3,543 functional associations with biological entities spanning 7 categories (molecular profile, chemical, functional term, phrase or reference, disease, phenotype or trait, structural feature, cell line, cell type or tissue, gene, protein or microRNA) extracted from 50 datasets.
CD8 TILs. IL7R. KLRG1. TNFSF4. ENTPD1. DHRS3. Nov 19, 2019 Background: Myocardial ischemia-reperfusion injury always happened after Off- pump coronary artery bypass graft(OPCABG), and this can not Nov 20, 2018 Genes such as MALAT1, H19, and MIR29C – whose links to hepatotoxicity Furthermore, genes such as Smim14 and Thyn1 were included in SMG9 · SMIM1 · SMIM10 · SMIM10L1 · SMIM11A · SMIM11B · SMIM12 · SMIM13 · SMIM14 · SMIM15 · SMIM18 · SMIM19 · SMIM2 · SMIM20 · SMIM22 · Therefore, we consider FCRLA, SMIM14, CD22, FCER2 and LINC00926 for further biological interpretation.
By Gene. Search Genes By Alphabetical Order: 0 1 2 3 4 5 6 7 8 9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z. 1 The information in the Mitelman Database of Chromosome Aberrations and Gene Fusions in Cancer relates cytogenetic changes and their genomic This study aimed to use gene chips to investigate differential gene expression profiles in the occurrence and development of SMIM14, -1.2562, 0.006733.